As we previously saw, in Designer 101 for every evolutionist! any expert designer or developer will never reinvent the wheel or redesign an existing design. Hence, common design pattern are not evidence of common ancestry but common framework used by an expert Designer. In this blog, we will do a practical test to see if an organism is designed or evolved, using a gene.

I will praise You, for I am fearfully [and] wonderfully made; Marvelous are Your works, And [that] my soul knows very well.

Ps 139:14

To do this little experiment, we need to test the genes that are designed to function differently to see if there is a possibility for being evolved or is it a cut / insert scenario. One such unique gene is HVRA (or Human accelerated region 1). HAR1A was identified in August 2006 when human accelerated regions (HARs) were first investigated. These 49 regions represent parts of the human genome that differ significantly from chimpanzee in terms of evolution. Hence, this gene is a good candidate to see if there is any small possibility of us being evolved from a common ancestor between chimps and humans.

HAR1-A Gene is located in humans at chr20:63102205-63104386 and have some matches with chimps at chr20:60485431-60486874. However, this is not a straight forward match.

With significant number of mutations, the first 389 positions from chimp aligns to human genome with negligible gaps. The 55bp from offset 1173 to 1227 position from chimp is not only present in human genome but also duplicated at positions 1099-1172 in human genome. Till then it’s fine and no issues with mutations which are in acceptable range.

Now, the real difference is below.

Chimp has the following sequence:

TGCTGCCTCAAGCCTAGGGCCAGCTCTCTAGAACGGCTCCAGCGGCTATTCGGGAG

While humans have the below sequence:

CGCCCAGAGCGGCCCAGGCCCTCGCGAGGAGACCGGCCTCCCCAGGGCGGGGCTTCCGACTCGGGCGCCCGTGAGCCCCGGAGGCGGCGCGAAGGGGCAGAGTCCGCGTTTCTAACCAGCCCCCGGGTGGGCGGTGGCCCGCGCGGCACGGTGGGCGCGAGCGCCGTGGGCTGGGGCCGGCCTGGGCTTTCAGGGCGAGGGCTTTCCGCGCCGGCCCCAGCCCACCCGGCCCCGCTGCGCGCCCCTCACGCTGCAGCCTGGGAACCTGGGCCGGGAGCTGCGGGCCGCTCCGGGGAAGCGGGCCTGACCTCCCCTCCCCACCGCCGCCCCTGCGGTGAGATCCTGCCTGCCGGGGCGCAGGGGCCCGCGGTTGGGCTCCGGGAGACGGAAGAGGCCCCACAGCTCGGGCCCCACGCAGTGGACGCTGCCACTTAATTTTGGCGTAATTGATGTCAAGGCGGGTGCCCGGGCCCCCAGTGAAATGCCTCATGAACTCGCTGCGAGGAACGGCGCTCCACGCGGTGCACGGTGGCCAATCAGAGCTGCCGCTTCTGATGGAGGCTGAGCCGGCTGGGGAGGCGTCTTGGCCAAGAACCAGCCCCAGCCTCGCTCAGGGCCCCAACCCGCAGACCATGTAATTAAGCTGCGTTCTGCAGCCAGGGCAAGGTGCGGAGGGGCCTGTTTCTAGCATTGGGGAGGAGGAAG

If you try to compare the sequence, you will notice that the chimp sequence is not found in human genome (not even a low identical match) and the human sequence is not found in chimps either. In other words, both chimps and humans are designed differently from a common framework using same genes, where the code is inserted separately by a Designer and did not evolve.